Is neo-darwinism a scientific theory?
Post Reply
 
Thread Rating:
  • 0 Votes - 0 Average
  • 1
  • 2
  • 3
  • 4
  • 5
04-12-2012, 09:34 PM (This post was last modified: 04-12-2012 09:42 PM by tiagorod84.)
RE: Is neo-darwinism a scientific theory?
"I'm sorry the fact that design theory is now being used in systems biology bothers you."

If by design theory you mean human design, or engineering, I have no problem at all!

"My position is simple in that why would a designer have to be supernatural? Why couldn't a designer be as natural as rain, and that maybe it is our limited thinking of the natural world that is the problem?"

Once again this is totally unclear... In my opinion this is called wishful thinking. New age at its best!

Irreducible complexity. You know it, I know it, everybody knows it: it's an F5 on 'god of the gaps'. Components of a complex system can have other functions and in fact they do. What has not yet an explanation... well, I remind you of your parable about the space shuttle, don't be so narrow minded.

"Would you then concede that ID is a scientific construct"

Man, I could use the entire scientific method and objective reasoning to study why Sauron only have one eye and not two (really, it could give him some perspective... Big Grin ). Would you call it scientific? I cannot empirically refute that Sauron is an one eyed prick. This would be pseudo-science.

The principle of falsifiability is crystal clear.

So, no! I couldn´t consider it science due to the reasons that I've told you.

Visit this user's website Find all posts by this user
Like Post Quote this message in a reply
04-12-2012, 10:17 PM (This post was last modified: 04-12-2012 10:22 PM by THEMAYAN.)
RE: Is neo-darwinism a scientific theory?
(04-12-2012 09:34 PM)tiagorod84 Wrote:  "I'm sorry the fact that design theory is now being used in systems biology bothers you."

If by design theory you mean human design, or engineering, I have no problem at all!

"My position is simple in that why would a designer have to be supernatural? Why couldn't a designer be as natural as rain, and that maybe it is our limited thinking of the natural world that is the problem?"

Once again this is totally unclear... In my opinion this is called wishful thinking. New age at its best!

Irreducible complexity. You know it, I know it, everybody knows it: it's an F5 on 'god of the gaps'. Components of a complex system can have other functions and in fact they do. What has not yet an explanation... well, I remind you of your parable about the space shuttle, don't be so narrow minded.

"Would you then concede that ID is a scientific construct"

Man, I could use the entire scientific method and objective reasoning to study why Sauron only have one eye and not two (really, it could give him some perspective... Big Grin ). Would you call it scientific? I cannot empirically refute that Sauron is an one eyed prick. This would be pseudo-science.

The principle of falsifiability is crystal clear.

So, no! I couldn´t consider it science due to the reasons that I've told you.
Well then I'm glad you have no problem with design theory which requires an intelligent agent.

My personal sensibilities as to nature and a designer are not relevant to the inference of design.

As for the space shuttle analogy, this is the wrong analogy for you to use, because ID is not based on our ignorance. On the contrary, it is based on what we now know, so If you have faith that someday someone can prove Behe wrong, then you are just admitting that irreducible complexity is falsifiable and that I only have to wait a couple of hundred years. I find that those that accuse others of the God gaps argument are simple issuing a promissory statement, i.e. just trust me, it will all work out the way I believe it will someday.

Thats fine but until then, we have to deal with the here and now, and what is the more plausible explanation, and I and a small but growing body of others propose ID as alternative theory. If you still wouldn't consider ID a scientific construct even when ID theorist get their work published in respected peer review journals, then why ask me to cite a publication you would not recognize as scientific? and I still see you have ignored my questions, those would be the sentences with question marks.
Find all posts by this user
Like Post Quote this message in a reply
04-12-2012, 10:56 PM (This post was last modified: 04-12-2012 11:20 PM by tiagorod84.)
RE: Is neo-darwinism a scientific theory?
(04-12-2012 10:17 PM)THEMAYAN Wrote:  Well then I'm glad you have no problem with design theory which requires an intelligent agent.

My personal sensibilities as to nature and a designer are not relevant to the inference of design.

As for the space shuttle analogy, this is the wrong analogy for you to use, because ID is not based on our ignorance. On the contrary, it is based on what we now know, so If you have faith that someday someone can prove Behe wrong, then you are just admitting that irreducible complexity is falsifiable and that I only have to wait a couple of hundred years. I find that those that accuse others of the God gaps argument are simple issuing a promissory statement, i.e. just trust me, it will all work out the way I believe it will.

Thats fine but until then, we have to deal with the here and now, and what is the more plausible explanation, and I and a small but growing body of others propose ID as alternative theory. If you still wouldn't consider ID a scientific construct even when ID theorist get their work published in respected peer review journals, then why ask me to cite a publication you would not recognize as scientific? and I still see you have ignored my questions, those would be the sentences with question marks.

The God of the gaps argument is not a promissory statement! It is the recognition that we still can't explain much things. Holding your argument on what is not understood, is not scientific! Putting the explanation of the unknown in the the super-natural world, well... you know my opinion.

I really don´t know if someone addressed Mr Behe examples in a scientific paper... And I surely won't waste much of my time on that. But, i can tell you this: the components of a complex system have other functions. And knowing this, evolution can explain complex assemblies. What you call irreducible complexity, like the blood clotting system, can function with more or less components, in different species.Therefore, irreducible complexity is just an erroneous view on complexity.
And yet my questions remain unanswered:

How can science deal with a concept that transcends the natural world?

The creator must transcend the creation. Otherwise, how can he create things in the first place. So that argument of 'rain and stuff' it's just wishful thinking and it's not even correct.

How can you empirically test the ID hypothesis?

Admit it, you'll never accept a good answer for irreducible complexity. And even if you do, you'll always come up with the argument: well that explanation fitts with design anyway... You can put a designer behind whatever you want. It can never be refuted. "Arguments that explain everything, explain nothing..."


(Note 1: I may not consider it scientific, but I really want to see those peer-reviewed articles.)

(Note 2: Please put those questions clearly. I'm almoast sleeping...)

Visit this user's website Find all posts by this user
Like Post Quote this message in a reply
05-12-2012, 12:29 AM
RE: Is neo-darwinism a scientific theory?
(04-12-2012 10:56 PM)tiagorod84 Wrote:  
(04-12-2012 10:17 PM)THEMAYAN Wrote:  Well then I'm glad you have no problem with design theory which requires an intelligent agent.

My personal sensibilities as to nature and a designer are not relevant to the inference of design.

As for the space shuttle analogy, this is the wrong analogy for you to use, because ID is not based on our ignorance. On the contrary, it is based on what we now know, so If you have faith that someday someone can prove Behe wrong, then you are just admitting that irreducible complexity is falsifiable and that I only have to wait a couple of hundred years. I find that those that accuse others of the God gaps argument are simple issuing a promissory statement, i.e. just trust me, it will all work out the way I believe it will.

Thats fine but until then, we have to deal with the here and now, and what is the more plausible explanation, and I and a small but growing body of others propose ID as alternative theory. If you still wouldn't consider ID a scientific construct even when ID theorist get their work published in respected peer review journals, then why ask me to cite a publication you would not recognize as scientific? and I still see you have ignored my questions, those would be the sentences with question marks.

The God of the gaps argument is not a promissory statement! It is the recognition that we still can't explain much things. Holding your argument on what is not understood, is not scientific! Putting the explanation of the unknown in the the super-natural world, well... you know my opinion.

I really don´t know if someone addressed Mr Behe examples in a scientific paper... And I surely won't waste much of my time on that. But, i can tell you this: the components of a complex system have other functions. And knowing this, evolution can explain complex assemblies. What you call irreducible complexity, like the blood clotting system, can function with more or less components, in different species.Therefore, irreducible complexity is just an erroneous view on complexity.
And yet my questions remain unanswered:

How can science deal with a concept that transcends the natural world?

The creator must transcend the creation. Otherwise, how can he create things in the first place. So that argument of 'rain and stuff' it's just wishful thinking and it's not even correct.

How can you empirically test the ID hypothesis?

Admit it, you'll never accept a good answer for irreducible complexity. And even if you do, you'll always come up with the argument: well that explanation fitts with design anyway... You can put a designer behind whatever you want. It can never be refuted. "Arguments that explain everything, explain nothing..."


(Note 1: I may not consider it scientific, but I really want to see those peer-reviewed articles.)

(Note 2: Please put those questions clearly. I'm almoast sleeping...)















Your doing the same in that you are speaking of the unknown as an answer. Unless of course your a fortune teller. It is exactly that, a promissory statement.




How do you know the components of irreducible complex systems have other functions? This is pure speculation and where is the data? Are you speaking of the T3SS, and concerning the blood clotting system Behe makes it clear although he is often misquoted by Miller who likes to point to the Dolphin as a refutation to Behe but Behe goes into great detail to explain why Miller is wrong and there is a debate video between the two that speak of this very topic.




I don't find knowledge and or trying to find a plausible mechanism for an irreducible complex system a waste of time. Again does a car designer have to transcend nature to create an automobile. ID does not attempt to answer who or what the designer is. This has to do with theology or philosophy not ID. ID does not even advocate that the designer is benevolent or personal. All ID does is make an inference to design based on the observable evidence.




Even if the designer can or could transcend space an time, it does not necessarily mean that nature is being transcended if the designer itself is a natural being. It only means that to our puny minds, it would seem super natural. Dawkins speaks of this same question concerning the possibility of ET superior beings that would seem God like to us, and he was not accused of using semantics.




There is no such thing as empirical proof in the historical sciences, again all we have is the observable evidence and I already told you that design theory is a part of an empirical science, and even gave you the field that it is used in. If anything how can you test evolution empirically and why does evolution get a free pass? Unless something is repeatable it cant be empirical? Can you repeat evolution? These are blatant dual standards.




If the cell was a product of chemistry and physics alone, then there would be no need for design theory and complex engineering principles to comprehend it, but biologist who deal with chemistry and physics alone require the aid of design theorist and engineers in this field. In this sense the proof is in the pudding.




How many design theorist and engineers does it take to study a rock? Answer, none. Petrologist are more than capable of doing so.




I cant admit anything that I have not yet been exposed to, and if you are not well read or knowledgable on the subject of irreducible complexity, then maybe it is a subject that you should stay away from.




Tell me, why do you think that peer review journals would (in this hostile climate to anything ID) publish articles by ID theorist who make a scientific argument based on the observable evidence if it wasn't scientific? Do you think they were duped or are a part of a Christian conspiracy? Answer the questions that I have given you in the last few post for a change, and I will be happy to cite them.
Find all posts by this user
Like Post Quote this message in a reply
05-12-2012, 07:49 AM
RE: Is neo-darwinism a scientific theory?
Giving citations means I can go and read the original materials and see any data myself, rather than relying on your opinion or the debates between individuals.

Give citations. Or ignore this post like all of my others.

Being nice is something stupid people do to hedge their bets
-Rick
Find all posts by this user
Like Post Quote this message in a reply
05-12-2012, 10:07 AM
RE: Is neo-darwinism a scientific theory?
Hey, Mayan.

I obviously don't agree with you, but I have no desire/need to dismiss you. That being said, there is no scientific basis for the intelligent design notion. If you want to believe in ID, more power to you. Unlike a lot of people here, I think it's perfectly fine for you to do so. But don't fool yourself into thinking there's some scientific basis. If you need that fabrication in order to cling to the notion of ID, then have at it. But if you're trying to convince others of ID, this route will fail you because it's snake oil territory. I think that championing ID as a scientific theory is just gonna land you in hot water.

In terms of panspermia, there is absolutely nothing in that idea that disproves evolution. It's a fine theory, not proven, but reasonable, but again, it's perfectly compatible with evolution.

In terms of neo-Darwinism, I have some issues with the current understanding of Darwinism simply because it's too genecentric (and DNAcentric). But these are all details that are being hashed out. The basic idea is as sound as it gets.

Quote:First of all, if you cannot tell the difference between the genomic
complexity of an organism, then how can you tell which organsim is more
complex from a simpler one?

I cannot comprehend your argument. Genome complexity plays what role in anything? Many plants have more complex genomes than humans. So what? What's the connection?

Quote:Again just based on genome size alone, i.e. the amount of genetic
information, it would seem that protozoa and lungfish are much more
complex than humans with our puny and measly 20-30 genes.

We have more than 20-30 genes.

Again, what does the length of a DNA molecule have to do with anything?

Quote:In a macro evolutionary paradigme of simple to complex, this becomes a problem.

Are you trying to say that evolution is a process where the simple becomes complex? Because if you are, nothing could be further from the truth. Evolution is not a process of amelioration, it's a process of change.

Quote:Secondly you missed the entire point about the Cambrian explosion, in
that there are no known ancestors to these phyla which appear abruptly,
globally and in orders of magnitude, and I am speaking of the initial
Cambrian radiation event, not to be confused with the 60 million year
record that proceeded it, and even this additional 60million years, it
is still regarded as blink of an eye in geological time.

At the time of the oxygen holocaust, 2.5 billion years ago, there were only bacteria. The other species came later. This is simple cladogenesis. I personally see no problem with the Cambrian. It makes sense to me.

To be fair though, even Charles Darwin recognised the possibility that the Cambrian challenged evolution. But the notion that it supports ID doesn't hold water. It couldn't have been caused by God, because he did his work 6 000 years ago. It couldn't have taken 70-80 million years because his work took 6 days. Even if it was God, he just snapped his finger and poof, horseshoe crabs and all the rest appeared, since then, beyond doubt, they've all been subject to evolution. Same if it was due to panspermia and same if aliens came to earth, drank some liquid and inexplicably dissolved and fell into the river (God damn that movie was terrible). The point is, even if new evidence alters the evolutionary pathway of Homo sapiens as known, what is beyond doubt is that humans evolved. We know, for fact, that this evolutionary process does not require a designer or a manipulator. If someone is, nifty. If someone seeded the world with Sea Monkeys, swell. If someone constantly pulls levers like the great machine in Metropolis, so be it. But like gravity and chemistry and aerodynamics, we know that evolution is an indisputable process of the natural universe.

Quote:And third, you have to assume that Cambrian phyla evolved into modern
creatures. In fact many of the Cambrian phyla still exist till this day
just as they were 530MY ago.

Little bit of column A, little bit of column B. What's the point?

Quote:You have no known sequence of fossils to prove this notion of yours.

Which notion?

Quote:My issue with human and chimp genome is that when it was thought that
our genomes were 99% similar, this was touted as undeniable proof.

Proof of what?

Quote:Now that we know that this is false, and that there is actually an
overall differential of 30% (which is around the same as we have
compared to horses) now the 30% becomes proof.

Let it be known that both the human and chimp genomes have been
sequenced. We know what the similarities are and it's in the 90% range.
Chimps are the most closely related to us. We didn't evolve FROM them.

Even if the percentage changes as we learn more about what DNA is and how it functions, it invalidates nothing.

As far as horses, we do share a lot of genes. We're both mammals. ALL mammals are descended from the same place. What's your point?

In terms of the differences, it has a lot to do with how genes function. There are three levels of genes. 1 - What to make. 2 - How long number 1 should be turned on in utero. 3 - Whether or not the gene should be turned on at all. The gene for tetrapodism is identical in all four legged organisms be they humans, chimps, horses, rats, crocodiles, eagles, komodo dragons, frogs, newts, herons, dolphins, whales or tiktaalik. The difference is in the second level gene that dictates how long that gene is turned on in utero. X amount of hours, you get a human arm. Y, a chimps arm, Z, a horse's leg. Q, a wing, N, a dolphin's fin.

Mammals share a bunch of genes: spines, eyes, tetrapodism, brains, the uterus, endothermia, and above all else, hair, claws and mammary glands. The big differences lie in how long these genes are turned on for and by extension, the differences in phenotype. When you compare humans to chimps, the similarities in the phenotype are obvious. When you look at the genome, you find out why.

So while humans, chimps and horses are all members of class mammalia, horses are not a part of order primates. Baboons are primates, but they aren't with us in family Hominidae. Orangutans are a part of our family, but not subfamily Homininae. Chimps are with us in Homininae but that's where we split, chimps living in tribe Panini, and the human clade living in tribe Hominini. Australopithecus is with us in that tribe, but after more cladogenesis, they wind up in subtribe Australopithecina and we in subtribe Hominina. At that point, humans and chimps and gorillas form three separate genera: Homo, Pan and Gorilla. And our genus, Homo, has had somewhere in the neighborhood of 20 species (the book is not at all closed on that one). Humans are closest to Neanderthals, less close to chimps, less close to gorillas, less close to orangutans, less close to baboons and less close to horses, whales and cats, but we're closer to all of those than we are to Christmas trees. Because every other species of Homo has gone extinct, leaving only Homo sapiens sapiens, Pan troglodytes and Pan paniscus are our closest living relatives.

Quote:With this kind of heads I win, tails you lose thinking, prokaryote to man evolution can never be falsified.

That's just strange. You're on about something, some denouncement of the human evolutionary path as understood in favour of ID, but I can't figure out what you're actually saying.

Quote:No, the ES does not refute evolution as a paradigme or concept, only as a
theoretical frame work, and the reason being, is we cannot honestly
divorce ourselves from neo Darwinism/the modern synthesis after all
these years of teaching it, if not as a dogma, at least a glorified
axiom.

That's preposterous.

Quote:What he does question, is the limitations of neo Darwinism, including
the limitations of natural selection to account for living things as we
know them, and again, when I speak of evolution, I mean prokaryote to
man evolution.

Prokaryote to man evolution is not the core of evolution. If that theory is wrong, it invalidates nothing.

Quote:Will the public accept a kind of statement such as......(OK we may have
been wrong about the mechanisms, and we may have been wrong for using
the neo Darwinian model at Dover, and we may have even been wrong for
villainizing other evolutionist who disagreed with the Darwinian model,
but this time its gona be different? This new extended synthesis is
going to have the real creamy feeling?

This is ludicrous.

Quote:There is no such thing as empirical proof in the historical sciences,
again all we have is the observable evidence and I already told you that
design theory is a part of an empirical science, and even gave you the
field that it is used in. If anything how can you test evolution
empirically and why does evolution get a free pass? Unless something is
repeatable it cant be empirical? Can you repeat evolution? These are
blatant dual standards.

That's ridiculous.

Quote:My personal reasons for not accepting evolutionary theory as taught, are
for completely different reasons as I advocate intelligent design,
which is a much different thing than evo devo who feel that chemistry
and physics alone can account for life. I have not heard one bit of
evidence that could not be challenged on a scientific level, and for the
life of me, I dont know why people cant discuss their views without
name calling.

I have no reason to call you names. You seem like a decent fellow. But your theories on this matter fail under scrutiny.

Your argument seems to be, "There is a flaw in some small part of evolution as taught, so I don't believe any of it." That's intellectually dishonest (provided I haven't created a strawman) and more importantly, evolution is strong enough to utterly crush such a notion. If there's a flaw with the synthesis, so be it. I'm not versed enough to challenge you on that point. But Darwin? I know Darwin. And his theory is doing just fine.

As far as you advocating ID, as I said, more power to you. But not only does that which is known crush that idea, you haven't provided any evidence to support it. What you have been doing is exactly what is described in Thank You for Smoking. If I champion vanilla ice cream and you champion chocolate, you aren't explaining why chocolate is better, you're explaining why vanilla is bad; hoping that people will accept chocolate as a result without you providing a single positive argument for it. If you have scientific evidence to support ID, I'd love to see it. Honestly. But I'm seeing right through this transparent strategy you're employing.

So, if you say there's issues with the synthesis, I accept your assertion on faith and look forward to more details about it so I can learn and grow. If you say that evolution fails on any level, sorry, but I call shenanigans. If, moving forward, you fail to provide any support for your theory and continue to focus on pointing out every flaw you can think of (the Thank You for Smoking Technique) I'm just gonna chalk this up to trolling and move on with my life. If you provide some evidence in support of ID, I'm all ears. As a systems theorist, I'm curious about what you're saying but I'd like to hear more because your current description is too vague.

Hey, Tia.

Quote:So, I yould like to recenter the debate: Does the extended synthesis:



A) Totally refutes the current theory of evolution?

B) Optimise the current theory of evolution?

Nothing refutes evolution.

If the attempt is to synthesise what we know about evolution, and PE and genetics and all the rest, then that's cool. If it's gotten some things wrong, so be it, get them fixed. So if doesn't so much optimise evolution, it just tries to contextualise it. But the theory of evolution itself is ironclad.

Hey, Chas.

Overall, I have to say, you've been rockin this thread, brother Cool

Quote:This is a lot like 'punctuated equilibrium overturns Darwinism'. It is overblown.

Indeed.

Quote:The framework of evolutionary theory is that descent with modification and selection occur. It is the description of an algorithm.

That's one of the most elegant descriptions I've ever heard. Descent with modification and selection. Beautiful.

And fo sho, it's an algorithm.

Quote:The vehicle for descent is DNA, the mechanism for modification is gene
modification, and selection is done by differential survival.

As a memeticist and a Universal Darwinist, I gotta jam my foot in this door before you close it. Sorry, brother Cool

DNA is not the vehicle of descent for genes per-se. ATCGGGCTAGCAAGCACGATGCTACTACGATCATCAGCGATCATC is a perfectly fine way to encode a gene. Genes can exist on pieces of paper or in computers or as graffiti on a wall. Scientists recently built a gene in a computer, printed it to a nucleotide sequence, implanted that molecule in an egg cell, inseminated a mother and brought the fully viable organism to term, the first known orgainism without parents. The reason DNA gets viewed incorrectly as the only vehicle for descent is because it is the only code we know of that cellular transcription machinery can read. So genes can exist anywhere, be copied anywhere, be mutated anywhere, because a gene is simply information, but as far as we know, they all have to come back to the DNA molecule if they want to be expressed.

But totally, gene modification (accidental mutation, engineering) causes variation and selection decides what flourishes and what is self-eliminating.

Peace and Love and Empathy,

Matt
Find all posts by this user
Like Post Quote this message in a reply
05-12-2012, 10:38 AM (This post was last modified: 05-12-2012 11:08 AM by tiagorod84.)
RE: Is neo-darwinism a scientific theory?
Previous note: Please put your posts in a readable format.

Science aspires to explain the unexplained. That's the driving force. Call it promissory, but it does not make it so!

Irreducible complexity IS a god of the gaps. You don't have an explanation, therefore we may infer it was a design... What kind of science is this?

Anyway in a quick search about the king of irreducibe complexity I've found this article: http://www.plosgenetics.org/article/info...en.1002983

The flagellum is a bad example, because of the TTSS. Now, you'll answer that the TTSS is irreducible complexity example. But, then you'll got to give two things:

1) Flagellum is not a irreducible complex system. There is one component that is funtional in non-flagellar organisms.
2) You see how you can continuously put that god of the gaps argument.

Even blood coagulation there are many articles about the evolution of these systems, here's a good one: http://bloodjournal.hematologylibrary.or.../2589.long

(I'm really not going to waste much more time on that. I really need to finish my PhD thesis... Weeping )

About the creator. It transcends the natural world, it does not transcend the natural. You don't really know. And yet you infer things... Way to go! You can be an open-minded persons to whatever New Age thing you want, but don't call it science.

Once again: science only deals with the natural world. That's the only reality we can aspire to understand.

There's no such thing as empirical proof. There's empirical refutation. And the creator, designer or the one-eyed Sauron (really two eyes would give him perspective on things) is not empirically refutable. Therefore the ID hypothesis is absolutely irrelevant for science!

About your questions: "why do you think that peer review journals would (in this hostile climate to anything ID) publish articles by ID theorist who make a scientific argument based on the observable evidence if it wasn't scientific?" I really don't know... Maybe a very open-minded (in the New Age sense) editor of a theoretical biology journal.

Do you think they were duped or are a part of a Christian conspiracy?
I don't really know the editors, but i have the tendency to be skeptical towards conspiracies.

My questions were not answered... So I guess this debate will continue ad eternum.

Visit this user's website Find all posts by this user
Like Post Quote this message in a reply
[+] 1 user Likes tiagorod84's post
05-12-2012, 11:57 AM
RE: Is neo-darwinism a scientific theory?
(05-12-2012 10:07 AM)Ghost Wrote:  
Quote:The vehicle for descent is DNA, the mechanism for modification is gene
modification, and selection is done by differential survival.

As a memeticist and a Universal Darwinist, I gotta jam my foot in this door before you close it. Sorry, brother Cool

DNA is not the vehicle of descent for genes per-se. ATCGGGCTAGCAAGCACGATGCTACTACGATCATCAGCGATCATC is a perfectly fine way to encode a gene. Genes can exist on pieces of paper or in computers or as graffiti on a wall. Scientists recently built a gene in a computer, printed it to a nucleotide sequence, implanted that molecule in an egg cell, inseminated a mother and brought the fully viable organism to term, the first known orgainism without parents. The reason DNA gets viewed incorrectly as the only vehicle for descent is because it is the only code we know of that cellular transcription machinery can read. So genes can exist anywhere, be copied anywhere, be mutated anywhere, because a gene is simply information, but as far as we know, they all have to come back to the DNA molecule if they want to be expressed.

But totally, gene modification (accidental mutation, engineering) causes variation and selection decides what flourishes and what is self-eliminating.

Thanks for the props, Matt.

I wasn't saying that DNA is the only possible means, but that it is what we've got here on earth for biological evolution. That is all.

At ease, memeticists. Smoke 'em if you've got 'em. Drinking Beverage

Skepticism is not a position; it is an approach to claims.
Science is not a subject, but a method.
[Image: flagstiny%206.gif]
Visit this user's website Find all posts by this user
Like Post Quote this message in a reply
05-12-2012, 01:28 PM
RE: Is neo-darwinism a scientific theory?
(05-12-2012 10:07 AM)Ghost Wrote:  Hey, Mayan.

I obviously don't agree with you, but I have no desire/need to dismiss you. That being said, there is no scientific basis for the intelligent design notion. If you want to believe in ID, more power to you. Unlike a lot of people here, I think it's perfectly fine for you to do so. But don't fool yourself into thinking there's some scientific basis. If you need that fabrication in order to cling to the notion of ID, then have at it. But if you're trying to convince others of ID, this route will fail you because it's snake oil territory. I think that championing ID as a scientific theory is just gonna land you in hot water.

In terms of panspermia, there is absolutely nothing in that idea that disproves evolution. It's a fine theory, not proven, but reasonable, but again, it's perfectly compatible with evolution.

In terms of neo-Darwinism, I have some issues with the current understanding of Darwinism simply because it's too genecentric (and DNAcentric). But these are all details that are being hashed out. The basic idea is as sound as it gets.
(05-12-2012 10:07 AM)Ghost Wrote:  Your entitled to your opinion but obviously there are peer review journals out there that disagree with you enough to publish the work of ID theorist even in this hostile climate.
Quote:First of all, if you cannot tell the difference between the genomic
complexity of an organism, then how can you tell which organsim is more
complex from a simpler one?

I cannot comprehend your argument. Genome complexity plays what role in anything? Many plants have more complex genomes than humans. So what? What's the connection?
(05-12-2012 10:07 AM)Ghost Wrote:  I already made my point concerning C Value enigma, and stated it clearly please go back and read carefully to person who asked me the same. I do not wish to repeat myself.
Quote:Again just based on genome size alone, i.e. the amount of genetic
information, it would seem that protozoa and lungfish are much more
complex than humans with our puny and measly 20-30 genes.

We have more than 20-30 genes.
(05-12-2012 10:07 AM)Ghost Wrote:  Again, what does the length of a DNA molecule have to do with anything?
(05-12-2012 10:07 AM)Ghost Wrote:  As for genes, I was giving a neo Darwinian gene centric view or estimate based on genes that code for proteins. The truth is we are now starting to redefine what the word gene means. The genome has gotten much more complex over the years. For further info there is a good article herehttp://www.ornl.gov/sci/techresources/Human_Genome/faq/genenumber.shtml
(05-12-2012 10:07 AM)Ghost Wrote:  
Quote:In a macro evolutionary paradigme of simple to complex, this becomes a problem.

Are you trying to say that evolution is a process where the simple becomes complex? Because if you are, nothing could be further from the truth. Evolution is not a process of amelioration, it's a process of change.
(05-12-2012 10:07 AM)Ghost Wrote:  False, if we are speaking of prokaryote to man evolution, then by definition, it is based on the assumption that simpler single celled creatures evolved through descent with modification to supposedly more complex multicellular creatures. How can you pretend this is not the same evolutionary process that is taught in schools all around the world?
Quote:Secondly you missed the entire point about the Cambrian explosion, in
that there are no known ancestors to these phyla which appear abruptly,
globally and in orders of magnitude, and I am speaking of the initial
Cambrian radiation event, not to be confused with the 60 million year
record that proceeded it, and even this additional 60million years, it
is still regarded as blink of an eye in geological time.

At the time of the oxygen holocaust, 2.5 billion years ago, there were only bacteria. The other species came later. This is simple cladogenesis. I personally see no problem with the Cambrian. It makes sense to me.

To be fair though, even Charles Darwin recognised the possibility that the Cambrian challenged evolution. But the notion that it supports ID doesn't hold water. It couldn't have been caused by God, because he did his work 6 000 years ago. It couldn't have taken 70-80 million years because his work took 6 days. Even if it was God, he just snapped his finger and poof, horseshoe crabs and all the rest appeared, since then, beyond doubt, they've all been subject to evolution. Same if it was due to panspermia and same if aliens came to earth, drank some liquid and inexplicably dissolved and fell into the river (God damn that movie was terrible). The point is, even if new evidence alters the evolutionary pathway of Homo sapiens as known, what is beyond doubt is that humans evolved. We know, for fact, that this evolutionary process does not require a designer or a manipulator. If someone is, nifty. If someone seeded the world with Sea Monkeys, swell. If someone constantly pulls levers like the great machine in Metropolis, so be it. But like gravity and chemistry and aerodynamics, we know that evolution is an indisputable process of the natural universe.
(05-12-2012 10:07 AM)Ghost Wrote:  You have not explained anything concerning the Cambrian explosion, and though it may make sense to you, it is still a mystery to a great many, evolutionist, and this is well documented. You said earlier that simple to complex was a false take on my part yet at the same time you also seem to be suggesting that simpler single celled creatures/cyanobacteria evolved into more complex Cambrian multicellular phyla, which destroys your own previous argument, and you are wrong, there were also ediacara biota which proceed cyanobacteria which appear first,[font=arial, sans-serif] however whether they were actually animals is still an open question, nevertheless these same biota go extinct millions of years before Cambrian radiation event. Secondly, even [/font]cyanobacteria (which is the same Cyanobacteria that exist today) [font=arial, sans-serif]started[/font] to [font=arial, sans-serif]diminish by 80% by the time of the CE[/font][font=arial, sans-serif]. Again, the [/font]Cambrian phyla were eukaryote multicellular creature which appeared abruptly, highly complex and within their own respected categories, and I know of no one in the field who has ever proposed that cyanobacteria were the ancestor of the Cambrian phyla, which again had already [font=arial, sans-serif]diminished by time of event[/font].[font=arial, sans-serif] Darwin didn't just recognize the possibility of the Cambrian explosion being a challenge to his theory, he regarded it as one of the best pieces of evidence against his theory. His consolation was the belief that future generation would redeem him by finding these transitional fossils required, yet this was a failed prediction and he clearly stated that if they could not be found, his theory was false.[/font]
(05-12-2012 10:07 AM)Ghost Wrote:  
Quote:And third, you have to assume that Cambrian phyla evolved into modern
creatures. In fact many of the Cambrian phyla still exist till this day
just as they were 530MY ago.

Little bit of column A, little bit of column B. What's the point?

Quote:You have no known sequence of fossils to prove this notion of yours.

Which notion?
(05-12-2012 10:07 AM)Ghost Wrote:  I have already been through this (refer to previous post
Quote:My issue with human and chimp genome is that when it was thought that
our genomes were 99% similar, this was touted as undeniable proof.

Proof of what?
(05-12-2012 10:07 AM)Ghost Wrote:  Supposed proof that we are ancestors of extinct ape like creatures who shared a common ancestor with chimps.
Quote:Now that we know that this is false, and that there is actually an
overall differential of 30% (which is around the same as we have
compared to horses) now the 30% becomes proof.

Let it be known that both the human and chimp genomes have been
sequenced. We know what the similarities are and it's in the 90% range.
Chimps are the most closely related to us. We didn't evolve FROM them.
(05-12-2012 10:07 AM)Ghost Wrote:  You need to read more carefully. I never claimed that we were supposed to have evolved from chimps, and let it be known that I gave the citations which according to wikipedia were sourced in the 2005 draft which breaks down the overall differential and arrives at a 70% figure. I even went out of my way to explain it in simpler language as well as citing the actual data.




Even if the percentage changes as we learn more about what DNA is and how it functions, it invalidates nothing.

As far as horses, we do share a lot of genes. We're both mammals. ALL mammals are descended from the same place. What's your point?

In terms of the differences, it has a lot to do with how genes function. There are three levels of genes. 1 - What to make. 2 - How long number 1 should be turned on in utero. 3 - Whether or not the gene should be turned on at all. The gene for tetrapodism is identical in all four legged organisms be they humans, chimps, horses, rats, crocodiles, eagles, komodo dragons, frogs, newts, herons, dolphins, whales or tiktaalik. The difference is in the second level gene that dictates how long that gene is turned on in utero. X amount of hours, you get a human arm. Y, a chimps arm, Z, a horse's leg. Q, a wing, N, a dolphin's fin.

Mammals share a bunch of genes: spines, eyes, tetrapodism, brains, the uterus, endothermia, and above all else, hair, claws and mammary glands. The big differences lie in how long these genes are turned on for and by extension, the differences in phenotype. When you compare humans to chimps, the similarities in the phenotype are obvious. When you look at the genome, you find out why.

So while humans, chimps and horses are all members of class mammalia, horses are not a part of order primates. Baboons are primates, but they aren't with us in family Hominidae. Orangutans are a part of our family, but not subfamily Homininae. Chimps are with us in Homininae but that's where we split, chimps living in tribe Panini, and the human clade living in tribe Hominini. Australopithecus is with us in that tribe, but after more cladogenesis, they wind up in subtribe Australopithecina and we in subtribe Hominina. At that point, humans and chimps and gorillas form three separate genera: Homo, Pan and Gorilla. And our genus, Homo, has had somewhere in the neighborhood of 20 species (the book is not at all closed on that one). Humans are closest to Neanderthals, less close to chimps, less close to gorillas, less close to orangutans, less close to baboons and less close to horses, whales and cats, but we're closer to all of those than we are to Christmas trees. Because every other species of Homo has gone extinct, leaving only Homo sapiens sapiens, Pan troglodytes and Pan paniscus are our closest living relatives.




Quote:With this kind of heads I win, tails you lose thinking, prokaryote to man evolution can never be falsified.

That's just strange. You're on about something, some denouncement of the human evolutionary path as understood in favour of ID, but I can't figure out what you're actually saying.



Quote:No, the ES does not refute evolution as a paradigme or concept, only as a
theoretical frame work, and the reason being, is we cannot honestly
divorce ourselves from neo Darwinism/the modern synthesis after all
these years of teaching it, if not as a dogma, at least a glorified
axiom.

That's preposterous.

Quote:What he does question, is the limitations of neo Darwinism, including
the limitations of natural selection to account for living things as we
know them, and again, when I speak of evolution, I mean prokaryote to
man evolution.

Prokaryote to man evolution is not the core of evolution. If that theory is wrong, it invalidates nothing.
(05-12-2012 10:07 AM)Ghost Wrote:  Again you said earlier that it made perfect sense in that we had prokaryote single celled bacteria evolving into multi celular Cambrian phyla which supposedly then evolved into mammals/man, now you say, that this is not the core of evolution. Are you sure you thought this one through?
Quote:Will the public accept a kind of statement such as......(OK we may have
been wrong about the mechanisms, and we may have been wrong for using
the neo Darwinian model at Dover, and we may have even been wrong for
villainizing other evolutionist who disagreed with the Darwinian model,
but this time its gona be different? This new extended synthesis is
going to have the real creamy feeling?

This is ludicrous.

Quote:There is no such thing as empirical proof in the historical sciences,
again all we have is the observable evidence and I already told you that
design theory is a part of an empirical science, and even gave you the
field that it is used in. If anything how can you test evolution
empirically and why does evolution get a free pass? Unless something is
repeatable it cant be empirical? Can you repeat evolution? These are
blatant dual standards.

That's ridiculous.

Quote:My personal reasons for not accepting evolutionary theory as taught, are
for completely different reasons as I advocate intelligent design,
which is a much different thing than evo devo who feel that chemistry
and physics alone can account for life. I have not heard one bit of
evidence that could not be challenged on a scientific level, and for the
life of me, I dont know why people cant discuss their views without
name calling.

I have no reason to call you names. You seem like a decent fellow. But your theories on this matter fail under scrutiny.

Your argument seems to be, "There is a flaw in some small part of evolution as taught, so I don't believe any of it." That's intellectually dishonest (provided I haven't created a strawman) and more importantly, evolution is strong enough to utterly crush such a notion. If there's a flaw with the synthesis, so be it. I'm not versed enough to challenge you on that point. But Darwin? I know Darwin. And his theory is doing just fine.

As far as you advocating ID, as I said, more power to you. But not only does that which is known crush that idea, you haven't provided any evidence to support it. What you have been doing is exactly what is described in Thank You for Smoking. If I champion vanilla ice cream and you champion chocolate, you aren't explaining why chocolate is better, you're explaining why vanilla is bad; hoping that people will accept chocolate as a result without you providing a single positive argument for it. If you have scientific evidence to support ID, I'd love to see it. Honestly. But I'm seeing right through this transparent strategy you're employing.

So, if you say there's issues with the synthesis, I accept your assertion on faith and look forward to more details about it so I can learn and grow. If you say that evolution fails on any level, sorry, but I call shenanigans. If, moving forward, you fail to provide any support for your theory and continue to focus on pointing out every flaw you can think of (the Thank You for Smoking Technique) I'm just gonna chalk this up to trolling and move on with my life. If you provide some evidence in support of ID, I'm all ears. As a systems theorist, I'm curious about what you're saying but I'd like to hear more because your current description is too vague.

Hey, Tia.
(05-12-2012 10:07 AM)Ghost Wrote:  You can chalk this up to anything you like, but my initial comment was about the initial question of thread, and I showed no hostility, and I did not even speak of ID until asked. If you call having a different opinion trolling, then we have to agree to disagree but at the same time, if someone or should I say some others wants to be a smart ass, then I'm one of the best at that. I do admit that I may have mistakenly responded to another post thinking it was direct at me, but there was nothing hostile about that particular instants. Peace.
Quote:So, I yould like to recenter the debate: Does the extended synthesis:



A) Totally refutes the current theory of evolution?

B) Optimise the current theory of evolution?

Nothing refutes evolution.

If the attempt is to synthesise what we know about evolution, and PE and genetics and all the rest, then that's cool. If it's gotten some things wrong, so be it, get them fixed. So if doesn't so much optimise evolution, it just tries to contextualise it. But the theory of evolution itself is ironclad.

Hey, Chas.

Overall, I have to say, you've been rockin this thread, brother Cool

Quote:This is a lot like 'punctuated equilibrium overturns Darwinism'. It is overblown.

Indeed.

Quote:The framework of evolutionary theory is that descent with modification and selection occur. It is the description of an algorithm.

That's one of the most elegant descriptions I've ever heard. Descent with modification and selection. Beautiful.

And fo sho, it's an algorithm.

Quote:The vehicle for descent is DNA, the mechanism for modification is gene
modification, and selection is done by differential survival.

As a memeticist and a Universal Darwinist, I gotta jam my foot in this door before you close it. Sorry, brother Cool

DNA is not the vehicle of descent for genes per-se. ATCGGGCTAGCAAGCACGATGCTACTACGATCATCAGCGATCATC is a perfectly fine way to encode a gene. Genes can exist on pieces of paper or in computers or as graffiti on a wall. Scientists recently built a gene in a computer, printed it to a nucleotide sequence, implanted that molecule in an egg cell, inseminated a mother and brought the fully viable organism to term, the first known orgainism without parents. The reason DNA gets viewed incorrectly as the only vehicle for descent is because it is the only code we know of that cellular transcription machinery can read. So genes can exist anywhere, be copied anywhere, be mutated anywhere, because a gene is simply information, but as far as we know, they all have to come back to the DNA molecule if they want to be expressed.

But totally, gene modification (accidental mutation, engineering) causes variation and selection decides what flourishes and what is self-eliminating.

Peace and Love and Empathy,

Matt
Find all posts by this user
Like Post Quote this message in a reply
05-12-2012, 02:59 PM (This post was last modified: 05-12-2012 03:07 PM by THEMAYAN.)
RE: Is neo-darwinism a scientific theory?
(05-12-2012 10:38 AM)tiagorod84 Wrote:  Previous note: Please put your posts in a readable format.

Science aspires to explain the unexplained. That's the driving force. Call it promissory, but it does not make it so!

Irreducible complexity IS a god of the gaps. You don't have an explanation, therefore we may infer it was a design... What kind of science is this?
(05-12-2012 10:38 AM)tiagorod84 Wrote:  Your assuming that yours is a default position. I can turn that around and say just because you don't understand how a designer could do it therefore you assume it evolved.




Irreducible complexity is only a description of a system that is irreducibly complex. Even Eugenie Scott who is the most critical of ID admits that IC is a valid construct. The only caveat is that she believes that a Darwinian process can explain IC systems, yet she nor anyone else has ever been able to explain or give a detailed account. I asked earlier if you were speaking of the T3SS, and you did not answer, and now you say you found an article which is about the TT3S. By your explanation it is evident you don't understand the subject. This is the problem with 5 minute google searches which is not the same as serious research. The bacterial flagellum which is made up of 40 to 50 proteins is irreducibly complex. If you remove just one part it will cease to function. Kenneth Miller who uses the TT3S model has admitted this fact, yet at the same time, his claim is that the TT3S shares at least 10 proteins with the BF. (this is what makes up the flagellum part) His reasoning is, if you remove 40 of the proteins from the BF, you will then end up with a TT3S. The problem with this, is that this has never been done. No one has ever been able to knock out these proteins and end up with a T3SS. The reason being because he lied, and was caught lying in front of an audience. Those so called ten proteins which were supposed to be the same are not the same. They are considered homologous or related per a Darwinian perspective in that they have some similar properties, but again, they are not the same proteins that Miller claimed. Secondly, in order for Kenneth Miller to prove his case concerning co option, (even if we excepted his lies) is he would have to show evidence that that TT3S is the precursor to the BF. All the data indicates the opposite. I also spoke of the blood clotting cascading system and the example of dolphins as supposed refutation to Behe's argument, but I leave it here for now.


[*]Evolution. As mentioned, the T3SS is closely related to the bacterial flagellum [11]. It is unresolved, however, exactly how the two are related. There are three competing hypotheses [12]: first, that the flagellum evolved first and the T3SS is derived from that structure, second, that the T3SS evolved first and the flagellum is derived from it, and third, that the two structures are derived from a common ancestor. Current opinion tends to favor the first option, where the T3SS is derived from an early flagellum.
[/list]
[edit]

^ Saier, M (2004). "Evolution of bacterial type III protein secretion systems". Trends in Microbiology 12 (3): 113–115. doi:10.1016/j.tim.2004.01.003. PMID 15001186.
(05-12-2012 10:38 AM)tiagorod84 Wrote:  Anyway in a quick search about the king of irreducibe complexity I've found this article: http://www.plosgenetics.org/article/info...en.1002983

The flagellum is a bad example, because of the TTSS. Now, you'll answer that the TTSS is irreducible complexity example. But, then you'll got to give two things:

1) Flagellum is not a irreducible complex system. There is one component that is funtional in non-flagellar organisms.
2) You see how you can continuously put that god of the gaps argument.

Even blood coagulation there are many articles about the evolution of these systems, here's a good one: http://bloodjournal.hematologylibrary.or.../2589.long

(I'm really not going to waste much more time on that. I really need to finish my PhD thesis... Weeping )

About the creator. It transcends the natural world, it does not transcend the natural. You don't really know. And yet you infer things... Way to go! You can be an open-minded persons to whatever New Age thing you want, but don't call it science.

Once again: science only deals with the natural world. That's the only reality we can aspire to understand.

There's no such thing as empirical proof. There's empirical refutation. And the creator, designer or the one-eyed Sauron (really two eyes would give him perspective on things) is not empirically refutable. Therefore the ID hypothesis is absolutely irrelevant for science!

About your questions: "why do you think that peer review journals would (in this hostile climate to anything ID) publish articles by ID theorist who make a scientific argument based on the observable evidence if it wasn't scientific?" I really don't know... Maybe a very open-minded (in the New Age sense) editor of a theoretical biology journal.

Do you think they were duped or are a part of a Christian conspiracy?
I don't really know the editors, but i have the tendency to be skeptical towards conspiracies.

My questions were not answered... So I guess this debate will continue ad eternum.
Find all posts by this user
Like Post Quote this message in a reply
Post Reply
Forum Jump: